Табл. Col V AII m

   Идентифицированные мутации в гене коллагена V типа альфа II

                           1) делеции

  Локализация :Делетированные нуклеотиды:           Литература            

  1924-1977 nt          54 bp                Michalickova K.,1998   

 Таблица Col VII AI del\t1\0

                          4) делеции
   Кодон:Кол-во делетир.:Делетированные:        Литература                
        :  нуклеотидов  :  нуклеотиды  :                                  
    62           1               g               Christiano A.M.,1997b   
   173           7            ggatcaa            Hovnanian A.,1997a   
   214           2              gt               Christiano A.M.,1997c   
   263           2              at               Christiano A.M.,1994c   
   294           1               g               Christiano A.M.,1996a   
   630           1               g               Christiano A.M.,1996h   
  1286           1               g               Christiano A.M.,1994c   
  1695           1               g               Christiano A.M.,1996h   
  1939           1               c               Christiano A.M.,1995a   
  2025           1               c               Christiano A.M.,1996h   
  2576           1               c               Christiano A.M.,1996a   
  2595           1               g               Mellerio J.E.,1997   
  2919           1               g               Christiano A.M.,1996h   
  I6/E7          5             gggca             Hovnanian A.,1997a   
  E115/I115     14        gaaggtgaggacag         Bruckner-Tuderman L.,1995   
  I114/E115-14  21                               Dunnill M.G.S.,1996   

                          5) инсерции
   Нуклеотид:  Кодон  :Инсерцированные:        Литература                 
            :         :  нуклеотиды   :                                   
    2470                     G                Christiano A.M.,1996c   
     114         39          A                Christiano A.M.,1996f   
     325        109         CG                Hovnanian A.,1997a   
     497        166          A                Christiano A.M.,1996f   
    6527       2175          C                Hovnanian A.,1997a   

                          6) делеции + инсерции
   Кодон:Делетированные:     Инсерцированные     :        Литература      
        :  нуклеотиды  :        нуклеотиды       :                        
   530    ccctggtgcca  : accgcatcattgccacccagtgccg      Hilal I.,1993   
  1700         cc      :            g                   Christiano A.M.,1996b   

Смотрите также:

  • Синдром Элерса-Данло: мутации генов Col V AI; Col V AII; Col III AI