Gene: [03q2/RHO] rhodopsin (visual pigment apoprotein); retinitis pigmentosa 4, (autosomal dominant; rhodopsin-related); congenital stationary night blindness 4; [RP4 RP5 CSNB4 ]
|
GEN |
The gene length is 6.7 kb. Exons: 5. Introns: 4. The 5'-UTL region of the cDNA is 95 bp and the 3'-UTL region is about 1.5 kb in length." |
|
MOP |
[1] Rhodopsin is a visual pigment of the retina photoreceptors. It
consists of an apoprotein, opsin, and a low-molecular chromophore,
11-cys-retinal (sometimes 11-cys-dehydroretinal), which are
covalently bound with each other.
[2] The primary translation product, opsin, contains 348 amino acid residues." |
|
HIS |
[1] It was originally assumed that the autosomal dominant retinitis
pigmentosa (clinical genetic variants being not taken into account)
is related to locus RP1, which was mapped to chromosome 1 on the basis
of slight linkage with Rh antigen genes (Field-1982, Daiger-1987
and others). Afterwards it was demonstrated (Bradley-1989,
Inglehearn-1990) that at least the infant form of RPD1 is not linked
with any marker in the short arm of chromosome 1 within a 250 cM
region, all the more with the Rh locus within its 50 cM vicinity. At
the same time, the form RPD1 (RP1, according to MIM-90, or RP4,
according to HGM-10.5) was found to be determined by the mutations of
the gene for the main retinal photoreceptor protein, rhodopsin
(Dryja-1990), which was previously mapped to chromosome 3q.
[2] More details on the early works on the RP mapping are reported by Daiger et al. in: |
|
HET |
Five clinical genetic forms of retinitis pigmentosa that is not complicated with any other disturbances (as deafness in Usher syndrome, GEM:01q41/USH2A) are definitely described. Among them are: - two autosomal dominant forms (D1 form, with onset in childhood before 10 years, characterized by symptoms of night blindness and diffuse retina lesion, and D2 form, with onset in youth or after 20 years of age, characterized by a focal lesion of retina); - two X-linked forms: GEM:0Xp113/RP2 and GEM:0Xp211/RP3; - one autosomal recessive form (MIM:268000), which is not mapped yet. The MIM catalogue includes 3 other recessive RP forms as secondary markers." |
|
MUT |
Dryja-1990 demonstrated that 11.5% patients with the infant form of RPD1 have a point mutation in 23d codon of the opsin gene: the C-->A transversion in the second position of the codon results in replacing Pro by His. Taking into consideration the pronounced conservativity of Pro in this position in all opsins, one can assume that its replacing disturbs substantially the apoprotein function and results in progression of the dominant form of retinitis." |
|
POL |
[1] PCR amplification with oligonucleotide probes Mfd2L/Mfd2R gave
the following 118-124-bp fragments:
Mfd2L - cattaggatgcattcttctg and Mfd2R - gtcaggattgaactgggaac.
---------------------------------------------------------
RFLP systems:
-------------
RFLP name (Reference; Probe number): Const Bands in kb;
Alleles in kb/(Popul Freq)
--------------------------------------------------------------------
[1] |
|
REF |
MUT,MOL,PAT "Berson EL &: Arch Ophthal, 109, 92-101, 1991 LOC,PAT,LIN "Bradley DG &: AJHG, 44, N4, 570-576, 1989 MUT,MOL,PAT "Dryja TP &: Nature Genet, 4, 280-283, 1993 MUT,MOL,PAT "Dryja TP &: Nature, 343, 364-366, 1990 MUT,MOL,PAT "Farrar GJ &: Hum Mol Genet, 1, 769-771, 1992 MUT,MOL,PAT "Farrar GJ &: Genomics, 11, 1170-1171, 1991 LIN,COM "Field LL &: J Med Genet, 19, 266-270, 1982 MUT,ASS,PAT "Fishman GA &: Arch Ophthal, 110, 646-653, 1992a MUT,ASS,PAT "Fishman GA &: Arch Ophthal, 110, 1582-1588, 1992b MUT,ASS,PAT "Fishman GA &: Arch Ophthal, 109, 1387-1393, 1991 MUT,MOL,PAT "Gal A &: Genomics, 11, 468-470, 1991 MUT,MOL,PAT "Heckenlively JR &: Arch Ophthal, 109, 84-91, 1991 LIN,COM "Heckenlively JR &: Ophthal Res, 14, 46-53, 1982 LIN,COM "Hussels-Maumenee &: AJHG, 27, 505-508, 1975 LOC,PAT,LIN "Inglehearn CF &: AJHG, 53, 536-537, 1993 LOC,PAT,LIN "Inglehearn CF &: AJHG, 50, 590-597, 1992a MUT,MOL,PAT "Inglehearn CF &: Hum Mol Genet, 1, 41-45, 1992b MUT,MOL,PAT "Inglehearn CF &: AJHG, 48, 26-30, 1991 LOC,PAT,LIN "Inglehearn CF &: J Med Genet, 27, 14-16, 1990 MUT,MOL,PAT "Keen TJ &: Genomics, 11, 199-205, 1991 MUT,MOL,PAT "Kranich H &: Hum Mol Genet, 2, 813-814, 1993 LOC,PAT,LIN "Kumar-Singh R &: AJHG, 52, 319-326, 1993 MUT,MOL,PAT "Macke JP &: AJHG, 53, 80-89, 1993 LOC,PAT,LIN "McWilliam P &: Genomics, 5, 619-622, 1989 GEN,MOP,EVO,LOC "Nathans J &: Science, 232, 193-202, 1986a GEN,MOP,EVO,LOC "Nathans J &: Science, 232, 203-210, 1986b CLO,GEN,SEQ,EXP "Nathans J, Hogness: PNAS, 81, (Aug), 4851-4855, 1984 LOC,PAT,LIN "Olsson JE &: Am J Med Genet, 35, 595-599, 1990 MUT,MOL,PAT "Rao VR &: Nature, 367, 639-642, 1994 MUT,ASS,PAT "Sheffield VC &: AJHG, 49, N4, 699-706, 1991 MUT,MOL,PAT "Sieving PA &: PNAS, 92, 880-884, 1995 MUT,ASS,PAT "Souied E &: Am J Ophthal, 121, 19-25, 1996 LOC,CYG,MOL "Sparkes RS &: Curr Eye Res, 5, 797-798, 1986a LOC,CYG,MOL "Sparkes RS &: Invest Ophthal Vis Sci, 127, 1170-1172, 1986b LIN,COM "Spence MA &: AJHG, 29, 397-404, 1977a LIN,COM "Spence MA &: AJHG, 29, (corrections), 592, 1977b MUT,ASS,PAT "Sullivan LJ &: Arch Ophthal, 111, 1512-1517, 1993 MUT,MOL,PAT "Sung C-H &: J Neurosci, 14, 5818-5833, 1994 MUT,MOL,PAT "Sung C-H &: JBC, 268, 26645-26649, 1993 MUT,MOL,PAT "Sung C-H &: PNAS, 88, 6481-6485, 1991 MUT,MOL,PAT "Vaithinathan R &: Genomics, 21, N2, 461-463, 1994 PRO,POL "Weber JL &: AJHG, 44, 388-396, 1989a PRO,POL "Weber JL &: CCG, 51, (HGM10), 1103, 1989b |
|
KEY |
eye, sign |
|
CLA |
coding, basic |
|
LOC |
03 q21.3-24 |
|
MIM |
MIM: 180380 |
|
SYN |
RP4 RP5 CSNB4 |
Смотрите также:
